Sequins ctDNA Evaluation Set

A new era of ctDNA accuracy: powerful calibration built into every sample.

Circulating tumor DNA (ctDNA) sequencing has fast become a powerful method for early detection, screening and recurrence monitoring of cancer. Liquid biopsies for ctDNA can quickly detect cancer-associated actionable variants, reveal information about cancer type and stage and response to therapies.

ctDNA is typically present at very low variant allele frequencies (VAFs) making detection accuracy dependent on high sequencing coverage, high fragment depth, and assay calibration.

Sequins internal standards enable precise estimation of VAFs, determination of the limit of detection (LoD), assay normalization, and calibration of variant calls against internal benchmarks.

Sequins internal control standards provide a powerful quality tool for ctDNA testing. By spiking known quantities of synthetic controls representing target variants into individual samples, sequencing assays can be normalized and variant calls calibrated against internal benchmarks.

Quantification and limit of detection calibration

Sequins representing synthetic cancer variants at varying allele frequencies provide a source of truth against which samples can be calibrated enabling confident and reliable identification of low-frequency variants.

Quality Control and Assay Validation

Sequins serve as an internal quality control and are subjected to the same technical influences as the samples they are combined with, enabling evaluation and optimization of key parameters related to sequencing workflows and sample quality.

Standardization Across Labs and Studies

Spike-in controls enable normalization both within and between samples, workflows, and locations to enable unprecedented standardization and interoperability.

Customizable Control Backbone with Molecular Ladder

The Sequins ctDNA Evaluation Set comprises a molecular ladder developed for the application of assessing variant allele frequency and sensitivity in the context of general cell-free cancer testing. The set targets twenty-two cancer genes with seventeen challenging INDELs and five SNPs at precise variant allele frequencies from 0.1 to 10% and is applicable to a range of cancers.

Gene	ClinVar UID	Variant	VAF %
BRCA1	ClinVar_1076672	c.2219_2220insTAAT (p.Ser741fs)	0.1
WT1	ClinVar_449416	c.1120C>T (p.Arg374Ter)	0.1
SMAD4	ClinVar_24867	c.1587dup (p.His530fs)	0.1
APC	ClinVar_1072211	c.476_488del (p.Tyr158_Tyr159insTer)	0.1
RB1	ClinVar_1073997	c.46_61GCC[2]GCGGAACCCCAGGCACCGCCGCCGCCGCCGCCGCGGAACCCC[1] (p.Pro21fs)	0.1
BRCA2	ClinVar_9342	c.658_659del (p.Val220fs)	0.5
PMS2	ClinVar_1328224	c.741_742insGTGTGTGAAG (p.Ser248fs)	0.5
TSC1	ClinVar_1013340	c.903dup (p.Asn302fs)	0.5
VHL	ClinVar_2218	c.499C>T (p.Arg167Trp)	0.5
MEN1	ClinVar_1070954	c.1375_1391dup (p.Ala467fs)	0.5
MAX	ClinVar_404110	c.211_221del (p.Ile71fs)	0.5
MLH1	ClinVar_89935	c.18_34del (p.Val7fs)	1.0
PTEN	ClinVar_545882	c.865_866insTTCT (p.Lys289fs)	1.0
SDHAF2	ClinVar_532513	c.177dup (p.Asp60Ter)	1.0
TSC2	ClinVar_237966	c.148A>G (p.Met50Val)	1.0
MSH6	ClinVar_1070916	c.3964_3980dup (p.Asn1327delinsLysAsnLeuArgArgTer)	5.0
BMPR1A	ClinVar_529927	c.366_384del (p.Glu123fs)	5.0
TMEM127	ClinVar_126966	c.265_268del (p.Thr89fs)	5.0
MSH2	ClinVar_90711	c.1638_1639dup (p.Asn547fs)	10.0
RET	ClinVar_230926	c.1998G>C (p.Lys666Asn)	10.0
STK11	ClinGen_CA402950689	g.1221314G>A (g.1221314G>A)	10.0
SDHB	ClinVar_428926	c.17_42dup (p.Ala15delinsProSerProTer)	10.0

The Sequins ctDNA Evaluation Set can be used as a backbone for further customization with additional gene targets through our Sequins On-Demand program.

Sequins Performance

Molecular ladder maintains linearity across all spike-in amounts.

Observed versus expected variant allele frequencies (VAFs) for synthetic Sequins variants. Twenty-two cancer gene variants representing varying allele frequencies (0.1%, 0.5%, 1%, 5%, 10%) were sequenced neat on Illumina NextSeq platform using IDT xGen cfDNA & FFPE Library prep kit v2 MC.

Compatibility with Existing Panels

The  Sequins Control Probe Set  showed no interference with the IDT Human ID Hyb Panel. Coverage uniformity across targets remained consistent whether captured alone or co-captured with the Sequins Control Probe Set and varying Sequins spike-in levels.

Apply Now

Sequins are simply ‘spiked-in’ to a sample prior to library preparation and together, progressed through a workflow. Sequins controls can then be distinguished from the native sample in the output library by their synthetic sequence enabling normalization and comparison between samples, runs, laboratories, chemistries, and sequencers.

01

Target sequences

02

Produce mirrored Sequins

03

Spike Sequins into samples

04

Prepare libraries and sequence

05

Analyze combined FASTQ files

06

Sequins act as internal controls

Designed to be run in combination with targeted gene panels, users can source a vendor to design and synthesize capture probes for the Sequins ctDNA Evaluation Set.

Provides a comprehensive backbone and can be further customized with additional gene targets through our On-Demand program.

We are releasing the Sequins ctDNA Evaluation Set through our Technology Access Program.

Apply Here!