Products & Applications

Sequins ctDNA
Evaluation Set

A new era of ctDNA accuracy: powerful calibration built into every sample.

Sequins ctDNA
Evaluation Set
Sequins ctDNA
Evaluation Set
Text Center Background

Circulating tumor DNA (ctDNA) sequencing has fast become a powerful method for early detection, screening and recurrence monitoring of cancer. Liquid biopsies for ctDNA can quickly detect cancer-associated actionable variants, reveal information about cancer type and stage and response to therapies.

 

ctDNA is typically present at very low variant allele frequencies (VAFs) making detection accuracy dependent on high sequencing coverage, high fragment depth, and assay calibration.

 

Sequins internal standards enable precise estimation of VAFs, determination of the limit of detection (LoD), assay normalization, and calibration of variant calls against internal benchmarks.

Tiles Background

Powerful ctDNA Controls

Sequins internal control standards provide a powerful quality tool for ctDNA testing. By spiking known quantities of synthetic controls representing target variants into individual samples, sequencing assays can be normalized and variant calls calibrated against internal benchmarks.

Quantification and limit of detection calibration

Sequins representing synthetic cancer variants at varying allele frequencies provide a source of truth against which samples can be calibrated enabling confident and reliable identification of low-frequency variants.

Quality Control and Assay Validation

Sequins serve as an internal quality control and are subjected to the same technical influences as the samples they are combined with, enabling evaluation and optimization of key parameters related to sequencing workflows and sample quality.

Standardization Across Labs and Studies

Spike-in controls enable normalization both within and between samples, workflows, and locations to enable unprecedented standardization and interoperability.
Tabs Content Background

Customizable Control Backbone with Molecular Ladder

The Sequins ctDNA Evaluation Set comprises a molecular ladder developed for the application of assessing variant allele frequency and sensitivity in the context of general cell-free cancer testing. The set targets twenty-three cancer genes with seventeen challenging INDELs and five SNPs at precise variant allele frequencies from 0.1 to 10% and is applicable to a range of cancers.

Gene ClinVar UID Variant VAF %
BRCA1 ClinVar_1076672 c.2219_2220insTAAT (p.Ser741fs) 0.1
WT1 ClinVar_449416 c.1120C>T (p.Arg374Ter) 0.1
SMAD4 ClinVar_24867 c.1587dup (p.His530fs) 0.1
APC ClinVar_1072211 c.476_488del (p.Tyr158_Tyr159insTer) 0.1
RB1 ClinVar_1073997 c.46_61GCC[2]GCGGAACCCCAGGCACCGCCGCCGCCGCCGCCGCGGAACCCC[1] (p.Pro21fs) 0.1
BRCA2 ClinVar_9342 c.658_659del (p.Val220fs) 0.5
PMS2 ClinVar_1328224 c.741_742insGTGTGTGAAG (p.Ser248fs) 0.5
TSC1 ClinVar_1013340 c.903dup (p.Asn302fs) 0.5
VHL ClinVar_2218 c.499C>T (p.Arg167Trp) 0.5
MEN1 ClinVar_1070954 c.1375_1391dup (p.Ala467fs) 0.5
MAX ClinVar_404110 c.211_221del (p.Ile71fs) 0.5
MLH1 ClinVar_89935 c.18_34del (p.Val7fs) 1.0
PTEN ClinVar_545882 c.865_866insTTCT (p.Lys289fs) 1.0
SDHAF2 ClinVar_532513 c.177dup (p.Asp60Ter) 1.0
TSC2 ClinVar_237966 c.148A>G (p.Met50Val) 1.0
MSH6 ClinVar_1070916 c.3964_3980dup (p.Asn1327delinsLysAsnLeuArgArgTer) 5.0
TP53 ClinVar_1066203 c.934_992dup (p.Ile332fs) 5.0
BMPR1A ClinVar_529927 c.366_384del (p.Glu123fs) 5.0
TMEM127 ClinVar_126966 c.265_268del (p.Thr89fs) 5.0
MSH2 ClinVar_90711 c.1638_1639dup (p.Asn547fs) 10.0
RET ClinVar_230926 c.1998G>C (p.Lys666Asn) 10.0
STK11 ClinGen_CA402950689 g.1221314G>A (g.1221314G>A) 10.0
SDHB ClinVar_428926 c.17_42dup (p.Ala15delinsProSerProTer) 10.0

The Sequins ctDNA Evaluation Set can be used as a backbone for further customization with additional gene targets through our Sequins On-Demand program.

Tabs Content Background
Tabs Content Background

Sequins Performance

Molecular ladder maintains linearity across all spike-in amounts.

 

Observed versus expected variant allele frequencies (VAFs) for synthetic Sequins variants. Twenty-three cancer gene variants representing varying allele frequencies (0.1%, 0.5%, 1%, 5%, 10%) were sequenced neat on Illumina NextSeq platform using IDT xGen cfDNA & FFPE Library prep kit v2 MC.

Tabs Content Background
Tabs Content Background

Compatibility with Existing Panels 



The  Sequins Control Probe Set  showed no interference with the IDT Human ID Hyb Panel. Coverage uniformity across targets remained consistent whether captured alone or co-captured with the Sequins Control Probe Set and varying Sequins spike-in levels.

 

Apply Now

Tabs Content Background

Designed to be run in combination with targeted gene panels, users can source a vendor to design and synthesize capture probes for the Sequins ctDNA Evaluation Set.

 

Provides a comprehensive backbone and can be further customized with additional gene targets through our On-Demand program.

 

We are releasing the Sequins ctDNA Evaluation Set through our Technology Access Program.

Get in Touch

Got a question or need guidance? Our team is ready to assist. Reach out and let us guide you toward the right solution.
Contact us